USGS - science for a changing world

St. Petersburg Coastal and Marine Science Center

Data Release

Cold-water Coral Microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon: Raw Data

By Christina A. Kellogg and Dawn B. Goldsmith

Summary

The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled “Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype.” They represent a 16S rRNA gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with the Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5′ AYTGGGYDTAAAGNG, rev: 5′ CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from bacteria in the Chlamydiales order from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5′ GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5′ TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012–2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011–2012. The raw data files associated with this study have also been submitted to the NCBI Sequence Read Archive under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. For more information, please see the README file.

Goldsmith, D.B., Kellogg, C.A., Morrison C.L., Gray, M.A., Stone, R.P., Waller, R.G., Brooke, S.D., and Ross, S.W., 2018, Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype: Scientific Reports, v. 8, Article number: 12383, https://doi.org/10.1038/s41598-018-30901-z.

Data

File Name and Description Metadata (XML format) Metadata (text format) Download File
Primnoa_raw_data.zip
Zip file containing raw data (.fna, .qual, .sff) and MIMARKS metadata.
Cold_water_coral_microbiomes_Primnoa_spp_
from_Gulf_of_Alaska_Baltimore_Canyon_and_
Norfolk_Canyon_raw_data.xml
Cold_water_coral_microbiomes_Primnoa_spp_
from_Gulf_of_Alaska_Baltimore_Canyon_and_
Norfolk_Canyon_raw_data.txt
Primnoa_raw_data.zip
(1.98 GB)
Chlamydiales_23S.txt
Text file containing two Sanger sequences
Not applicable Not applicable Chlamydiales_23S.txt
(1 KB)
Supplemental Information
Primnoa_workflow.txt
Details the scripts run in the bioinformatic package QIIME version 1.9.1
Not applicable Not applicable Primnoa_workflow.txt
(42 KB)
README_Primnoa.txt
Readme file explaining data
Not applicable Not applicable README_Primnoa.txt
(7 KB)
Primnoa3008_map.txt
Mapping file to accompany sequencing files ID2UZ7K01.sff and ID2UZ7K02.sff
Not applicable Not applicable Primnoa3008_map.txt
(2 KB)
Primnoaprim1_map.txt
Mapping file to accompany sequencing files H8MF54001.sff and H8MF54002.sff
Not applicable Not applicable Primnoaprim1_map.txt
(3 KB)

Locations of sampling.
Locations of sampling.

Suggested Citation

Kellogg, C.A., and Goldsmith, D.B., 2018, Cold-water coral microbiomes (Primnoa spp.) from Gulf of Alaska, Baltimore Canyon, and Norfolk Canyon—raw data: U.S. Geological Survey data release, https://doi.org/10.5066/F7P55KMJ.



Accessibility FOIA Privacy Policies and Notices

Take Pride in America logo USA.gov logo U.S. Department of the Interior | U.S. Geological Survey
URL: http://coastal.er.usgs.gov/data-release/doi-F7P55KMJ/index.html
Page Contact Information: Feedback
Page Last Modified: December 18, 2018 @ 12:44 PM (JSG)